Image
LifeFormulae, LLC
9119 Highway 6 South #228
Missouri City, TX 77459
(713) 472-6700  
 

LARTS Online GenBank example for amidohydrolase

LOCUS		BC151478		1429 bp	mRNA	linear  MAM  9-JUN-2008
DEFINITION	Bos taurus amidohydrolase domain containing 2, mRNA (cDNA clone MGC:179382 IMAGE:8558625), complete cds
ACCESSION	BC151478
VERSION		BC151478.1  GI:154425851
KEYWORDS	MGC.
SOURCE		Bos taurus (cattle)
   ORGANISM	Bos taurus
		Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Ruminantia; Pecora; Bovidae; Bovinae; Bos
REFERENCE	1 (bases 1 to 1429)
AUTHORS		Moore, S., Alexander, L., Brownstein, M., Guan, L., Lobo, S., Meng, Y., Tanaguchi, M., Wang, Z., Yu, J., Prange, C., Schreiber, K., Shenmen, C., Wagner, L., Bala, M., Barbazuk, S., Barber, S., Babakaiff, R., Beland, J., Chun, E., Del Rio, L., Gibson, S., Hanson, R., Kirkpatrick, R., Liu, J., Matsuo, C., Mayo, M., Santos, R.R., Stott, J., Tsai, M., Wong, D., Siddiqui, A., Holt, R., Jones, S.J., Marra, M.A.
TITLE		Direct Submission. 
JOURNAL		Submitted (31-JUL-2007)  Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, British Columbia, Canada, Suite 100, 570 West 7th Avenue, V5Z 4S6 
COMMENT		Contact: Robert Kirkpatrick
		Canada's Michael Smith Genome Sciences Centre
		BC Cancer Agency
		Suite 100, 570 West 7th Avenue, Vancouver, British Columbia, Canada, V5Z 4S6
		Tel: 1 604 707 5900 x5406
		Fax: 1 604 876 3561
		Email: robertk@bcgsc.ca
		Tissue Procurement: M. Taniguchi, Y. Meng, S. Lobo, L. Guan and S. Moore
		cDNA Library Preparation: M. Masaaki, Y. Meng, S. Lobo,  L. Guan and Dr. S. Moore
		cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL)
		DNA Sequencing by: Bovine Genome Sequencing Program, Genome Sequence Centre,
		BC Cancer Agency, Vancouver, BC, Canada
		info@bcgsc.bc.ca
		Moore S, Alexander L, Brownstein M, Guan L, Lobo S, Meng Y, Tanaguchi M, Wang Z, Prange C, Schreiber K, Shenmen C, Wagner L, Ali J, Chun E, Liao N, Beland J, Cruz K, Featherstone R, Kirk H, Matsuo C, Mayo M, Moore R, Munro S, Roger J, Tam B, Trinh E, Sze W, Wilton J, Wanger S, Huang P, Chu B, Imanian B, Roscoe R, Holt R, Jones S, Marra M

		Clone distribution: MGC clone distribution information can be found through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov
		Series: IRAK Plate: 320 Row: g Column: 1
ORIGIN		1429 bp	linear
>gi|154425851|gb|BC151478.1| Bos taurus amidohydrolase domain containing 2, mRNA (cDNA clone MGC:179382 IMAGE:8558625), complete cds
GTGGGCGCCTCCGGCTCGGCTGGGCTCAGGATGCGCGGCGGGCAGGGCGCGGCGCGGGCC
CCGGTGATCCAGTTCACCAACTGCCGCATCTTGAGGGGTGGCGCGCTGCTCAGGGAGGAC
CTCTGGGTGCGCGGGGGCCGCATCCTGGACCCGGAGAAGCTGTTCTTTGAGGAGCGGCGC
GTGGCTGACGAGCAGCGGGACTGCGGCGGCTGCATCTTGGCGCCCGGCTTCATCGACGTG
CAGATCAACGGTGGATTTGGCGTTGACTTCTCACAAGCCTCGGAGGACGTGGGTTCGGGG
GTTGCCCTAGTGGCCCGGAGGATCCTGTCGCATGGAGTCACCTCTTTCTGCCCCACGTTG
GTCACATCGCCACTGGAGGTTTATCACAAGGTCCTTCCTCAGATCCCTGTGAAGAGTGGT
GGTCCCCATGGGGCAGGGGTCCTCGGGGTGCACCTGGAGGGCCCATTCATCAGCCGGGAG
AAGCGGGGCGCGCACCCCGAGGCCCACCTGCGCTCCTTTGAAGCTGACGCTTTCCAAGAC
GTGCTGGCCACCTACGGGGGCCTGGACAATGTCCGCATCGTGACGCTGGCCCCCGAGCTG
GGCCACAGCCAGGAGGTGATCCGGGCGCTGACGGCCCTCGGCATCTGCGTGTCCTTAGGG
CACTCGGTGGCTGACCTGGGGACTGCGGAGGAAGCCGTGCAGAGTGGGGCCACCTTCATC
ACCCACCTCTTCAACGCCATGCTGCCTTTCCACCACCGCGACCCAGGCATCGTGGGGCTC
CTGACCAGCGATCGGCTGCCTGCAGGCCGTCATATTTTCTACGGGATGATTGCTGACGGT
ATACACACCAACCCGGCCGCCCTGCGCATCGCCCACCGGGCCCATCCCAAGGGGCTGGTG
CTAGTCACTGATGCTGTCCCTGCACTGGGCTTGGGCAACGGCCGACACACGCTGGGGCAG
CAGGAGGTGGAGGTGGATGGGCTGACAGCTTATGTGGCAGGCACCAACACACTGAGCGGC
AGCATCGCCCCGATGGACACCTGCGTGCGGCACTTCCTGCAGGCCACAGGCTGCAGTGTG
GAGTCCGCTCTGGAGGCTGCGTCCCTGCATCCAGCACAGCTGCTGGGGCTGGAGAAGCGC
AAGGGGACCCTGGACTTCGGGGCTGACGCAGACTTCGTGGTGCTCGACGACTCTCTTCAC
GTCCGGGCCACCTACATCTCGGGCGAGCTGGTGTGGCAGGTGGAGGAGGCCAGGCCGTGA
CCCAGGACCACCGCTGGAGGGGATGCCCAGCCCCAGCTGGACACTGTCGGTTGGGCATTG
GGGAGCTGGTCTCAAGAGAGAGGAGGGAGCCTCGGCCCAGGTGGAGGCCTCAGCCCGGAG
TCGGCGGCTTGGATAAACATGTGCCCCGTAGGGAAAAAAAAAAAAAAAA
FEATURES		Location/Qualifiers
  source	1..1429
		/organism="Bos taurus"
		/genus="Bos"
		/species="taurus"
		/mol_type="mRNA"
		/dbxref="taxon:9913"
		/clone="MGC:179382 IMAGE:8558625"
		/tissue-type="Fetal liver, 6 month male fetus, Hereford"
		/clone-lib="GC_BGC-14"
		/lab-host="DH10B"
		/strain="Hereford"
		/other="Vector: pCMV-SPORT6.0"
  gene		1..1429
		/gene="AMDHD2"
		/db_xref="GeneID:521401"
  CDS		31..1260
		/gene="AMDHD2"
		/codon_start="1"
		/db_xref="GeneID:521401"
		/product="AMDHD2 protein"
		/protein_id="AAI51479.1"
		/db_xref="GI:154425852"
		/translation="MRGGQGAARAPVIQFTNCRILRGGALLREDLWVRGGRILDPEKLFFEERRVADEQRDCGGCILAPGFIDVQINGGFGVDFSQASEDVGSGVALVARRILSHGVTSFCPTLVTSPLEVYHKVLPQIPVKSGGPHGAGVLGVHLEGPFISREKRGAHPEAHLRSFEADAFQDVLATYGGLDNVRIVTLAPELGHSQEVIRALTALGICVSLGHSVADLGTAEEAVQSGATFITHLFNAMLPFHHRDPGIVGLLTSDRLPAGRHIFYGMIADGIHTNPAALRIAHRAHPKGLVLVTDAVPALGLGNGRHTLGQQEVEVDGLTAYVAGTNTLSGSIAPMDTCVRHFLQATGCSVESALEAASLHPAQLLGLEKRKGTLDFGADADFVVLDDSLHVRATYISGELVWQVEEARP"
  graph		1..1429
		/graph_title="Phrap Quality"
		/graph_numvals="1429"
		/gene="AMDHD2"
//
 
 
LifeFormulae, LLC ©    Home  |  Contact Us  |  Site Map  |  Privacy Policy | LifeFormulae Blog