Image
LifeFormulae, LLC
9119 Highway 6 South #228
Missouri City, TX 77459
(713) 472-6700  
 

LARTS Online GenBank example for aminotransferase

>gi|197292134|gb|EU871618.1| Gulo gulo tyrosine aminotransferase gene, partial cds.
GAGACGAGGTAAGAACAATTTGGTGAATGGTACTTCTAATTTAGTATATATGTATATATT
TACTTTGCACGCAGTGGTTAGGAGGTGATTTTTGTTGTTGTTGTAGTGTTTTTTTTTTTC
CCCCTTCTCCTTGGTCCTGTAGTTCTGGGTGCCTGGAAAAATGCTGGTAAAGAGGGTACT
AGTTATTCCTTTCCAAAACTCGGTTTTCCTGTACCTGGCTCTGTGAAGAAGTTCCATCCG
CCTCTAGTTTTCAGACTGCAAAAAGGCAAACAATAGCGGTAATGATCCCTGGTATTATTT
GGAGGCTTACGATGTGCCAACGTTCAAAATACATCATTTTAATTTAATCCTCCCTGCAAC
CCGATGAGGCCAGGATTAGTATCATCTACCTTTTATGGCTGAGAAAAGTGAGGCACTAAG
ACGTTGTATCATTTGCCCAGAGTCATACCGGAGGTATGTGACAGAGCTGGGCTAAAACCC
AAGTGGTCTAATCCAAGAATGCCACTAGGCACCATCACTTCTTCAGAGATGTAAAGCCTG
ATGAAAAGAATGGTCAGAACAAGAATCCCCAAACTGGAATGCTTAAGGAAGGCTAAATAA
TCTGTTTGCCGGGGCACTTTAG
>gi|197292135|gb|ACH57477.1| tyrosine aminotransferase [Gulo gulo]
DE
 
 
LifeFormulae, LLC ©    Home  |  Contact Us  |  Site Map  |  Privacy Policy | LifeFormulae Blog