Image
LifeFormulae, LLC
9119 Highway 6 South #228
Missouri City, TX 77459
(713) 472-6700  
 

LARTS Online GenBank example for actinin

>gi|113911877|gb|BC122618.1| Bos taurus actinin, alpha 3, mRNA (cDNA clone MGC:140041 IMAGE:8286739), complete cds
CTTAACGCGGCCCCCGTGTTCTGGAGCGCGCCGAGCAGAGCGGAGCCAGGAGCCCGAACA
AGATGATGATGGTTCTGCAGCCCGAGGGTCTGGGGACCGGGGAGGGGCCCTTCGCGGGCG
GCCGTGGGGGCGGCGAATACATGGAACAGGAGGAGGACTGGGACCGCGACCTGCTGTTGG
ACCCGGCCTGGGAGAAGCAGCAGCGGAAAACCTTCACTGCCTGGTGCAACTCACACCTGC
GCAAGGCTGGCACCCAGATCGAGAACATCGAGGAGGATTTCCGCAATGGCCTCAAACTCA
TGTTGCTCCTGGAGGTTATTTCAGGAGAGAGGCTGCCCAGACCAGACAAAGGCAAGATGC
GCTTCCACAAGATTGCCAATGTCAACAAGGCCCTGGATTTCATTGCCAGCAAGGGGGTGA
AGCTGGTGTCCATCGGTGCTGAAGAGATTGTTGACGGGAACCTGAAGATGACCCTGGGCA
TGATCTGGACCATCATCCTTCGCTTTGCCATCCAGGACATCTCCGTGGAAGAAACCTCGG
CCAAGGAAGGCTTGCTCCTGTGGTGTCAGCGGAAGACGGCGCCGTACCGCAACGTCAACG
TGCAGAACTTCCACACCAGCTGGAAGGATGGGCTGGCCCTCTGTGCTCTCATCCACCGAC
ACCGCCCCGACCTCATTGACTATGCCAAACTGCGCAAGGACGACCCCATCGGCAACTTGA
ACACCGCCTTTGAGGTGGCCGAGAAGTACCTGGACATCCCTAAGATGCTGGATGCAGAAG
ACATTGTGAACACCCCAAAGCCTGATGAGAAGGCCATCATGACCTATGTCTCCTGCTTCT
ACCACGCCTTTGCCGGGGCGGAGCAGGCAGAGACAGCTGCCAACAGGATCTGCAAAGTGC
TGGCCGTGAACCAGGAGAACGAGAAGCTGATGGAGGAATATGAAAAGCTGGCCAGTGAGC
TACTGGAATGGATCCGCCGGACCGTGCCGTGGCTGGAGAACCGCGTGGGCGAGCCCAGCA
TGAGCGCCATGCAACGCAAGCTGGAAGACTTCCGGGACTACCGGCGCCTGCACAAGCCGC
CCCGCGTGCAGGAGAAGTGCCAGCTGGAGATTAACTTCAACACACTGCAGACCAAGCTGC
GGCTGAGCCACCGGCCGGCCTTCATGCCATCTGAGGGCAAGCTGGTCTCGGACATCGCCA
ACGCATGGCGGGGCCTGGAGCAGGCAGAGAAGGGCTATGAGGATTGGCTGCTCTCCGAGA
TCCGGCGCCTACAGCGGCTGCAGCACCTGGCGGAGAAGTTCCAGCAGAAGGCCTCCCTGC
ATGAAGCCTGGACCCGGGGAAAGGAGGACATGCTGAGCCAGAGGGACTACGAGACGGCTT
CGCTGCAGGAGGTGCGGGCCTTGCTGCGGCGCCACGAGGCCTTCGAGAGCGACCTGGCGG
CGCACCAGGACCGCGTGGAGCACATCGCTGCGCTGGCCCAGGAGCTCAATGAGCTGGACT
ACCACGAGGCAGCCTCGGTGAACAGCCGCTGCCAGGCCATCTGTGACCAGTGGGACAACC
TGGGCACGCTGACCCAGAAGAGGCGGGATGCACTGGAGCGGATGGAGAAGCTCCTAGAGA
CCATCGATCAGCTACAGCTGGAGTTTGCCCGGCGGGCAGCGCCCTTCAACAACTGGCTGG
ACGGCGCCGTGGAGGACCTGCAGGACGTGTGGCTGGTGCACTCGGTGGAGGAGACCCAGA
GCTTGGTGACAGCACACGACCAGTTCAAGGCAACACTGCCCGAGGCCGACCGAGAGAGGG
GTGCCATCCTGGGCATCCAGGGTGAGATCCAGAAGATCTGCCAAACGTACGGACTGCGGC
CCAGCTCCACCAACCCCTACATCACCCTCACCCCGCAGGACATCAACACCAAGTGGGACA
CGGTCCGAAAGCTGGTACCCAGCCGTGACCAGATGCTGCAGGAGGAGCTGACGCGGCAGC
AGGTGAACGAGAGGCTCCGGCGGCAGTTTGCAGCCCAGGCCAACGCCATCGGGCCCTGGA
TCCAGGGGAAGGTGGAGGAAGTGGGGCGCCTAGCCGCGGGGATGGCCGGCTCTCTGGAGG
AGCAGATGGCGGGCCTGCGGCAGCAGGAGCAGAATATCATCAACTACAAGAGCAACATCG
ACCGGCTGGAGGGAGACCACCAGCTGCTGCAGGAGAGTCTGGTGTTTGACAACAAGCACA
CGGTCTACAGCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCTCCATCGCAC
GCACCATCAACGAGGTGGAGAACCAGGTACTGACCCGAGACGCCAAGGGCCTGAGTCAGG
AGCAGCTCAACGAGTTCCGGGCATCTTTCAACCACTTTGACCGGAAGCGGAATGGCATGA
TGGAGCCTGATGACTTCCGGGCCTGCCTCATCTCCATGGGCTATGACCTGGGGGAGGTGG
AGTTCGCTCGCATCATGACCATGGTGGACCCCAACGCAGCTGGGGTTGTGACCTTCCAAG
CCTTCATCGACTTTATGACCCGAGAGACAGCCGAGACAGACACGGCTGAGCAGGTTGTGG
CCTCGTTCAAGATCCTGGCGGGAGACAAGAACTACATCACCGCCGAGGAGCTGCGGCGGG
AACTCCCGGCGGAGCAGGCCGAGTACTGCATCCGCCGCATGGCGCCCTACAAGGGGGCTG
GGGCTCCAGCTGGAGCCCTGGACTACGTGGCCTTCTCCAGTGCCCTCTACGGGGAGAGTG
ACCTCTGACGTTGACCCCAGAGCTTCCCTACTCAAGTCCGGAGAGAGGGTGCTCCCTCTG
GCTGATCCCACCCATCCCTTGGAGCCATGGCCACAGAGCCGAGTGTTTCTCAATAAAGAT
CCATCGTGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>gi|113911878|gb|AAI22619.1| Actinin, alpha 3 [Bos taurus]
MMMVLQPEGLGTGEGPFAGGRGGGEYMEQEEDWDRDLLLDPAWEKQQRKTFTAWCNSHLR
KAGTQIENIEEDFRNGLKLMLLLEVISGERLPRPDKGKMRFHKIANVNKALDFIASKGVK
LVSIGAEEIVDGNLKMTLGMIWTIILRFAIQDISVEETSAKEGLLLWCQRKTAPYRNVNV
QNFHTSWKDGLALCALIHRHRPDLIDYAKLRKDDPIGNLNTAFEVAEKYLDIPKMLDAED
IVNTPKPDEKAIMTYVSCFYHAFAGAEQAETAANRICKVLAVNQENEKLMEEYEKLASEL
LEWIRRTVPWLENRVGEPSMSAMQRKLEDFRDYRRLHKPPRVQEKCQLEINFNTLQTKLR
LSHRPAFMPSEGKLVSDIANAWRGLEQAEKGYEDWLLSEIRRLQRLQHLAEKFQQKASLH
EAWTRGKEDMLSQRDYETASLQEVRALLRRHEAFESDLAAHQDRVEHIAALAQELNELDY
HEAASVNSRCQAICDQWDNLGTLTQKRRDALERMEKLLETIDQLQLEFARRAAPFNNWLD
GAVEDLQDVWLVHSVEETQSLVTAHDQFKATLPEADRERGAILGIQGEIQKICQTYGLRP
SSTNPYITLTPQDINTKWDTVRKLVPSRDQMLQEELTRQQVNERLRRQFAAQANAIGPWI
QGKVEEVGRLAAGMAGSLEEQMAGLRQQEQNIINYKSNIDRLEGDHQLLQESLVFDNKHT
VYSMEHIRVGWEQLLTSIARTINEVENQVLTRDAKGLSQEQLNEFRASFNHFDRKRNGMM
EPDDFRACLISMGYDLGEVEFARIMTMVDPNAAGVVTFQAFIDFMTRETAETDTAEQVVA
SFKILAGDKNYITAEELRRELPAEQAEYCIRRMAPYKGAGAPAGALDYVAFSSALYGESD
L
 
 
LifeFormulae, LLC ©    Home  |  Contact Us  |  Site Map  |  Privacy Policy | LifeFormulae Blog